View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8383_low_23 (Length: 260)
Name: NF8383_low_23
Description: NF8383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8383_low_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 22 - 192
Target Start/End: Original strand, 48305563 - 48305733
Alignment:
| Q |
22 |
atggaaaaacacacggtcaagggggctttaatcggtgattgaatattgcacgactcgtattctgacttcactaaattggttttaaaatacatcttagaat |
121 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48305563 |
atggaaaaacacacggtcaagggggcttcaatcggtgattgaatattgcacgactcgtattccgacttcactaaattggttttaaaatacatcttagaat |
48305662 |
T |
|
| Q |
122 |
atgagtcgtcttctaatagttgagatctgctattgtctgactgtaaagaatccaaatgcaaacataagagg |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
48305663 |
atgagtcgtcttctaatagttgagatctgctattgtctgactgtaaagaatccgaatgcaaacataagagg |
48305733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University