View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8383_low_28 (Length: 235)
Name: NF8383_low_28
Description: NF8383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8383_low_28 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 1 - 117
Target Start/End: Original strand, 6682647 - 6682763
Alignment:
| Q |
1 |
atggcaaagaatcgatttctaaattgttgccttgtatcttaagtgactttagcattgaaagaggagtggtggatgtgtccagagcgtctttcaatggttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6682647 |
atggcaaagaatcgatttctaaattgctgccttgtatcttaagtgactttagcatggaaagaggagtggtggatgtgtccagagcgtctttcaatggttt |
6682746 |
T |
|
| Q |
101 |
cagtgtagattcacaca |
117 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
6682747 |
cagtgtagattcacaca |
6682763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 116 - 213
Target Start/End: Original strand, 6682881 - 6682978
Alignment:
| Q |
116 |
catcttctttcgacttccatccccgaagtttatcacaagaagatatactaagtctctctaaagttgggaagaatgttgctgcagttggagaaacccat |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6682881 |
catcttctttcgacttccatccccgaagtttgtcacaagaagatatactaagtctctctaaagttgggaagaatgttgctgcagttggagaaacccat |
6682978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University