View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8383_low_31 (Length: 215)
Name: NF8383_low_31
Description: NF8383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8383_low_31 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 103 - 198
Target Start/End: Complemental strand, 43128470 - 43128375
Alignment:
| Q |
103 |
aatcaattcgaagtcaaggacatttgattaagttgaaaagatcacttatcgtcttgtctaaatgttgttgaattttgatctttctccctttaatta |
198 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
43128470 |
aatcagttcgaagtcaaagacatttgattaagttgaaaagatcacttatcatcttatctaaatgttgttgaattttgatctttctccttttaatta |
43128375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 17 - 74
Target Start/End: Complemental strand, 43128554 - 43128497
Alignment:
| Q |
17 |
aatgagtgaaggcattataaaatgtgggaaatgaagttttgagtatacttatcattag |
74 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43128554 |
aatgagtgaaggcattataaaatgtgggaaatgaagttttgagtatccttatcattag |
43128497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University