View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8383_low_4 (Length: 425)
Name: NF8383_low_4
Description: NF8383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8383_low_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 359; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 359; E-Value: 0
Query Start/End: Original strand, 34 - 412
Target Start/End: Complemental strand, 30199120 - 30198742
Alignment:
| Q |
34 |
tcagtgtcgtgtccatgcatcatagctttcaatcaaaattgacatgtctagtagcagttagaccaaaacttttatcattatcatttcaacaaacatgttg |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
30199120 |
tcagtgtcgtgtccatgcatcatagctttcaatcaaaattgacatgtctagtagtagttagaccaaaacttttatcattgtcatttccacaaacatgttc |
30199021 |
T |
|
| Q |
134 |
tgagctattattttttcaatgattacttacaactgcaatatttttaggttctaacaatgattataaaaggattgtttagaagatataaaaaatggaaccc |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30199020 |
tgagctattattttttcaatgattacttacaactgcaatatttttaggttctaacaatgattataaaaggattgtttagaagatataaaaaatggaaccc |
30198921 |
T |
|
| Q |
234 |
cgttcatccaacttatggagcattttatggaatgggtttcggcgttggttgtggtgttggatggggtcctggatttggtcctgaagttgttggttatgtt |
333 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30198920 |
tgttcatccaacttatggagcattttatggaatgggtttcggcgttggttgtggtgttggatggggtcctggatttggtcctgaagttgttggttatgtt |
30198821 |
T |
|
| Q |
334 |
ggagctggttgcggtgttggattcaatgttggtatcactcttgttggttttggaattggtcttcctgctaatgtcatct |
412 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30198820 |
ggagctggttgcggtgttggattcaatgttggtatcactcttgttggttttggaattggtcttcctgctaatgtcatct |
30198742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University