View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8383_low_7 (Length: 411)
Name: NF8383_low_7
Description: NF8383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8383_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 320; Significance: 1e-180; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 1 - 403
Target Start/End: Complemental strand, 12200975 - 12200580
Alignment:
| Q |
1 |
gagaaaaaggaaaattgagtgatgagatttttgtgagtgatgtggtttaatggtgttgaatattgaggttgtgtgtgggggtttatgtagacactaagat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12200975 |
gagaaaaaggaaaattgagtgatgagatttttgtgagtgttgtggtttaatggtgttgaatattgaggttgtgtgtgggggtttatgtagacactaagat |
12200876 |
T |
|
| Q |
101 |
ggagtgtgtatggtttgtgaaagtgtgtgaactgttgtgtgtagcactggatctagctggaaattttggtggatcccactggattctactttgaaaatga |
200 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12200875 |
ggagtgtatatggtttgtgaaagagtgtgaactgtt-tgtgtagcactggatctagctggaaattttggtggatcccactggattctactttgaaaatga |
12200777 |
T |
|
| Q |
201 |
tgttgaataagcacatatcacagtcatccggatcgataatatctgatgtcannnnnnnnnnnnnngtcttaaaaagaatttagtttaaggtaaattaatt |
300 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||||| ||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
12200776 |
tgttgaataagcacatatcatagtcatccggatctataataactgatgtca------ttttttttgtcttaaaaagaatttagtttaaggtaaattaatt |
12200683 |
T |
|
| Q |
301 |
gttaagttcttttcatatttcttttattccatgatataaagttttttgaggaaaagttatttcattttataatgtaatcaatttcttttgtttatatatc |
400 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12200682 |
gttaagttcttttcatatttcttttattccatgatatgaagttttttgaggaaaagttatttcattttataatgtaatcaatttcttttgtttatatatc |
12200583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University