View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8384_high_6 (Length: 239)

Name: NF8384_high_6
Description: NF8384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8384_high_6
NF8384_high_6
[»] chr5 (2 HSPs)
chr5 (135-228)||(7446740-7446833)
chr5 (19-64)||(7446631-7446676)


Alignment Details
Target: chr5 (Bit Score: 82; Significance: 8e-39; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 135 - 228
Target Start/End: Original strand, 7446740 - 7446833
Alignment:
135 atgaacgttcgttcatatgagctctgggctcgatgatatccaaaccgtacattattaagttttcacttctcagccacacgatatttcatctcac 228  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||    
7446740 atgaacgttcgttcatatgagctctgggctcgatgaaatccaaaccgtacattattaagttttcactactcagccacacgatatttcatgtcac 7446833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 64
Target Start/End: Original strand, 7446631 - 7446676
Alignment:
19 gttgatagagagaagaaacactagcatgcaaccggttctttaggac 64  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
7446631 gttgatagagagaagaaacactagcatgcaaccggttctttaggac 7446676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University