View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8384_high_6 (Length: 239)
Name: NF8384_high_6
Description: NF8384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8384_high_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 82; Significance: 8e-39; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 135 - 228
Target Start/End: Original strand, 7446740 - 7446833
Alignment:
| Q |
135 |
atgaacgttcgttcatatgagctctgggctcgatgatatccaaaccgtacattattaagttttcacttctcagccacacgatatttcatctcac |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
7446740 |
atgaacgttcgttcatatgagctctgggctcgatgaaatccaaaccgtacattattaagttttcactactcagccacacgatatttcatgtcac |
7446833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 64
Target Start/End: Original strand, 7446631 - 7446676
Alignment:
| Q |
19 |
gttgatagagagaagaaacactagcatgcaaccggttctttaggac |
64 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7446631 |
gttgatagagagaagaaacactagcatgcaaccggttctttaggac |
7446676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University