View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8384_low_7 (Length: 249)
Name: NF8384_low_7
Description: NF8384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8384_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 106; Significance: 4e-53; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 1 - 149
Target Start/End: Original strand, 35303059 - 35303205
Alignment:
| Q |
1 |
tggtggattcatggttggttaatgcaatgctttgtttttcagttccagtattttaaaatgcttctgttgtataattagagtgaatagcttagcttagttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
35303059 |
tggtggattcatggttggttaatgcaatgctttgtttttcagttcaagtattttaaaatgcttctgttgtataattagagtgaatagtttagctcagttg |
35303158 |
T |
 |
| Q |
101 |
gccgatgcataaaatatatgcaaaggtttgaggatcgaacctcgaccac |
149 |
Q |
| |
|
|| ||||||||| |||||||||| ||||||||||||| |||| |||| |
|
|
| T |
35303159 |
tccaatgcataaa--atatgcaaagatttgaggatcgaaactcggccac |
35303205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University