View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8385_high_14 (Length: 329)
Name: NF8385_high_14
Description: NF8385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8385_high_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 264; Significance: 1e-147; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 15 - 314
Target Start/End: Original strand, 13137044 - 13137343
Alignment:
| Q |
15 |
aaacagaagaagtatctacaacgcagaaggtcctcggattgtatgagaatgtgccattatgatgaataatcaaagggtttggatttgaaactgaagattt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13137044 |
aaacagaagaagtatctacaacgcagaaggtcctcggattgtatgagaatgtgccattgtgatgaataatcaaagggtttggatttgaaactgaagattt |
13137143 |
T |
 |
| Q |
115 |
aatgtttgggactagttttgcatgtgacttgccgccaccactaggannnnnnnncaaaggagagttaagttgagatgtttccacaagctttcttgaacga |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13137144 |
aatgtttgggactagttttgcatgtgacttgccaccaccactaggatttgttttcaaaggagagttaagttgagatgtttccacaagctttcttgaacga |
13137243 |
T |
 |
| Q |
215 |
tttcgacctctgtgcatgtgacgttcacaatacttctgattaggtactgtgtccttaccgcacctccatttctttccgtcagttcttctacacctatgtg |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13137244 |
tttcgacctctgtgcatgtgacgttcacaatacttctgattaggtactgtgtccttgccgcacctccatttctttccgtcagttcttctacacctatgtg |
13137343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 193 - 249
Target Start/End: Original strand, 7246548 - 7246604
Alignment:
| Q |
193 |
ttccacaagctttcttgaacgatttcgacctctgtgcatgtgacgttcacaatactt |
249 |
Q |
| |
|
||||||| ||||||||||||| |||| ||||||||||||||| | |||||| ||||| |
|
|
| T |
7246548 |
ttccacaggctttcttgaacggtttctacctctgtgcatgtgtctttcacagtactt |
7246604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University