View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8385_low_16 (Length: 345)
Name: NF8385_low_16
Description: NF8385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8385_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 18 - 340
Target Start/End: Original strand, 15406055 - 15406378
Alignment:
| Q |
18 |
gaaaaaatggtaacttgttggattttcagtttttgcaaaggaatagtaatgtttt-ttatgtattcttaaacagtttcctttactttacacattcacttc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15406055 |
gaaaaaatggtaacttgttggattttcagtttttgcaaaggaatagtaatgtttttttatgtattcttaaacagtttcctttactttacacattcacttc |
15406154 |
T |
|
| Q |
117 |
ataccatttttatctttatgtattgattcattataagcacaataactcataattgaatcttttgctttttcactttatagcaataataacttctcatttg |
216 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
15406155 |
ataccatttttatctttatgtattggttcattataagcacaataactcataattgaatcttttgctttttcactttatagcaataataacttcttatttg |
15406254 |
T |
|
| Q |
217 |
tcctctcacctatattttccatctttgtttatctattctcagctgaagtaattttcactattttgcagttataggcaaaaactaaacgtgaaaaactggt |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15406255 |
tcctctcacctatattttccatctttgtttatctattctcagctgaagtaattttcactattttgcagttataggcaaaaactaaacgtgaaaaactggt |
15406354 |
T |
|
| Q |
317 |
cattctctgaaacttcttctcact |
340 |
Q |
| |
|
||| ||||||||||||| ||||| |
|
|
| T |
15406355 |
tattttctgaaacttcttgtcact |
15406378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University