View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8385_low_19 (Length: 316)

Name: NF8385_low_19
Description: NF8385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8385_low_19
NF8385_low_19
[»] chr7 (1 HSPs)
chr7 (1-304)||(47678364-47678665)


Alignment Details
Target: chr7 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 1 - 304
Target Start/End: Original strand, 47678364 - 47678665
Alignment:
1 caaggtttgagtgatgcatataattgatagattctcgagcattggaattttgttttggcagaaagtgtcaaaaatttggggggcatttcccccaccaggt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47678364 caaggtttgagtgatgcatataattgatagattctcgagcattggaattttgttttggcagaaagtgtcaaaaatttggggggcatttcccccaccaggt 47678463  T
101 cacatggtaaaacacagaagtgagccaaaaaactatagtaccgcacattattgcaaagtcatttaaggcaaggcaaagaactgttgtggtctcagactca 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47678464 cacatggtaaaacacagaagtgagccaaaaaactatagtaccgcacattattgcaaagtcatttaaggcaaggcaaagaactgttgtggtctcagactca 47678563  T
201 gacatatgtgtatgtggactcactcacctctgctgtaacttgcaaactaacaaatgctaaaaaaggctatgtattatggtcttcacattgcaacaacacc 300  Q
    ||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
47678564 gacata--tgtatgtggactcactcacctctgctgtaacttgcaaactaacaaatgctaaaaaaggctatgtattatggtcttcacattgcaacaacatc 47678661  T
301 aaac 304  Q
    ||||    
47678662 aaac 47678665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University