View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8385_low_23 (Length: 291)
Name: NF8385_low_23
Description: NF8385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8385_low_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 276; Significance: 1e-154; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 1 - 280
Target Start/End: Original strand, 25206978 - 25207257
Alignment:
| Q |
1 |
tgcacttggtactgctcttctctgttacgtgactccaaaagaacatctcgggttgccaaaccgagatgatgtgaaggatggagtgatagcttacaagatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25206978 |
tgcacttggtactgctcttctctgttacgtgactccaaaagaacatctcgggttgccaaaccgagatgatgtgaaggatggagtgatagcttacaagatt |
25207077 |
T |
|
| Q |
101 |
gctgctcatgctgctgatttagccaaacaacatccacatgctcaagcctgggacgatgccttaagcaaggcgagatttgaattccggtggatggaccagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25207078 |
gctgctcatgctgctgatttagccaaacaacatccacatgctcaagcctgggacgatgccttaagcaaggcgagatttgaattccggtggatggaccagt |
25207177 |
T |
|
| Q |
201 |
ttgctttgtctttggatccgatgacagccatgtccttccacgatgaaactttgccatcggaaggtgcaaaggtggttcat |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
25207178 |
ttgctttgtctttggatccgatgacagccatgtccttccacgatgaaactttgccatcggaaggtgcaaaggtggctcat |
25207257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 2 - 275
Target Start/End: Original strand, 25195695 - 25195968
Alignment:
| Q |
2 |
gcacttggtactgctcttctctgttacgtgactccaaaagaacatctcgggttgccaaaccgagatgatgtgaaggatggagtgatagcttacaagattg |
101 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||| | |
|
|
| T |
25195695 |
gcacttggtactgctcttctctgttatgtgactccaaaagaacatctcgggttgccaaaccgagatgatgtgaaggctggagttatagcttacaagatag |
25195794 |
T |
|
| Q |
102 |
ctgctcatgctgctgatttagccaaacaacatccacatgctcaagcctgggacgatgccttaagcaaggcgagatttgaattccggtggatggaccagtt |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||| ||||| || |||||||||||||| |
|
|
| T |
25195795 |
ctgctcatgctgctgatttagccaaacaacatccacacgctcaagaatgggacgatgccttaagcaaggcgagattcgaatttcgatggatggaccagtt |
25195894 |
T |
|
| Q |
202 |
tgctttgtctttggatccgatgacagccatgtccttccacgatgaaactttgccatcggaaggtgcaaaggtgg |
275 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||| ||||| || |||||||||||||||| |
|
|
| T |
25195895 |
tgctttgtcattggatccaatgacagccatgtccttccacgatgaaacattgccgtcagaaggtgcaaaggtgg |
25195968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University