View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8385_low_31 (Length: 224)
Name: NF8385_low_31
Description: NF8385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8385_low_31 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 7935287 - 7935493
Alignment:
| Q |
1 |
gaggaatggagtaaaagaacgtttaagtgtgaatgtttaattgctcttgaccaatataagcacaagacattaatccaaggagtaaacctggagtataatt |
100 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||| ||| || ||||||||| |
|
|
| T |
7935287 |
gaggaatggagtaaaagaacgtatgagtgtgaatgtttaactgctcttgaccattataagcacaagacattaatccaaggagttaacatgtagtataatt |
7935386 |
T |
 |
| Q |
101 |
tatcaacaacataactatgatcaagcaccataattacaaccacagaagcaaacttgttgagaagtaattatcctatctttgctcacaagcaaccaccact |
200 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||| ||| |
|
|
| T |
7935387 |
tatcaccaacataactatgatcaagcaccataattacaaccacagaagcaaacttgttgcgaagtaattatcctatctttgttcacaagcaacccggact |
7935486 |
T |
 |
| Q |
201 |
taattat |
207 |
Q |
| |
|
||||||| |
|
|
| T |
7935487 |
taattat |
7935493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University