View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8386_low_14 (Length: 229)
Name: NF8386_low_14
Description: NF8386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8386_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 40378238 - 40378026
Alignment:
| Q |
1 |
aagatagataaatacctgaggttcaaaatcttcggatagtaatacatttgatgattttacatcccgatgaatcacgggatgatcatctttacaatgcaga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
40378238 |
aagatagataaatacctgaggttcaaaatcttcagatagtaatacattggatgattttacatcccgatgaatcacgggatgatcgtctttacaatgcaga |
40378139 |
T |
|
| Q |
101 |
tattccaaagcttcagcaacgcctgttgcaaccttatatctctgtgtccaaccaaactcgcgagggtttttcttagtccctaatttagcatggaaaagaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40378138 |
tattccaaagcttcagcaacgcctgttgcaaccttatatctctgtgtccaaccaaactcgcgagggtttttcttagtccctaatttagcatggaaaagaa |
40378039 |
T |
|
| Q |
201 |
ataagtatgatgt |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
40378038 |
ataagtatgatgt |
40378026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 13 - 160
Target Start/End: Complemental strand, 10259696 - 10259549
Alignment:
| Q |
13 |
tacctgaggttcaaaatcttcggatagtaatacatttgatgattttacatcccgatgaatcacgggatgatcatctttacaatgcagatattccaaagct |
112 |
Q |
| |
|
|||||||||||||||||| || |||| ||| |||||||||||||||||||| ||||| ||||| || || ||| ||| ||||||||| |||||||| |
|
|
| T |
10259696 |
tacctgaggttcaaaatcctcagataataacacatttgatgattttacatcacgatggatcacaggttggtcactgttattatgcagatactccaaagcc |
10259597 |
T |
|
| Q |
113 |
tcagcaacgcctgttgcaaccttatatctctgtgtccaaccaaactcg |
160 |
Q |
| |
|
||||||||||| |||| ||||||||||||| |||||||| |||||| |
|
|
| T |
10259596 |
tcagcaacgcccattgccaccttatatctctcagtccaacctaactcg |
10259549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University