View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8388_high_3 (Length: 331)

Name: NF8388_high_3
Description: NF8388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8388_high_3
NF8388_high_3
[»] chr6 (1 HSPs)
chr6 (249-311)||(7212913-7212975)


Alignment Details
Target: chr6 (Bit Score: 59; Significance: 6e-25; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 249 - 311
Target Start/End: Original strand, 7212913 - 7212975
Alignment:
249 acctccctcttcctttgtcgtgccacactgtaaaactctcatctctctcgtcctttgcctttg 311  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
7212913 acctccctcttcctttgtcgcgccacactgtaaaactctcatctctctcgtcctttgcctttg 7212975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University