View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8388_high_3 (Length: 331)
Name: NF8388_high_3
Description: NF8388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8388_high_3 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 59; Significance: 6e-25; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 249 - 311
Target Start/End: Original strand, 7212913 - 7212975
Alignment:
| Q |
249 |
acctccctcttcctttgtcgtgccacactgtaaaactctcatctctctcgtcctttgcctttg |
311 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7212913 |
acctccctcttcctttgtcgcgccacactgtaaaactctcatctctctcgtcctttgcctttg |
7212975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University