View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8388_low_6 (Length: 295)
Name: NF8388_low_6
Description: NF8388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8388_low_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 15 - 285
Target Start/End: Original strand, 28218308 - 28218578
Alignment:
| Q |
15 |
tcacatagtatgttcaatattgtcgttcttattaacaataatttgtttggtcttaattccttaacaatttgtcatttgatagaactttttaaccacttga |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28218308 |
tcacatagtatgttcaatattgtcgttcttattaacaataatttgtttgatcttaattccttaacaatttgtcatttgatagaactttttaaccacttga |
28218407 |
T |
|
| Q |
115 |
atcaaattacttgattattaacaatacttgattctaaatgtttaaggatagtgctcgttatctagtgtaacctcatgatcaagttatgcattgatatact |
214 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28218408 |
atcaaattgcttgattattaacaatacttgattctaaatgtttaaggatagtgctcgttatctagtgtaacctcatgatcaagttatgcattgatatact |
28218507 |
T |
|
| Q |
215 |
atagtgttgaattcaatattctatgtgctattgttttgtcaagatattctatgaactttgtcatgttcatc |
285 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28218508 |
atagtgttgaattcaatattctatgagctattgttttgtcaagatattctatgaactttgtcatgttcatc |
28218578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 72 - 128
Target Start/End: Original strand, 26400647 - 26400703
Alignment:
| Q |
72 |
tccttaacaatttgtcatttgatagaactttttaaccacttgaatcaaattacttga |
128 |
Q |
| |
|
||||||||||||| || |||||| || ||| |||||||||||||||||||| ||||| |
|
|
| T |
26400647 |
tccttaacaatttatcttttgattgagcttattaaccacttgaatcaaattgcttga |
26400703 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University