View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8389_low_5 (Length: 264)
Name: NF8389_low_5
Description: NF8389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8389_low_5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 201; Significance: 1e-110; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 6 - 248
Target Start/End: Complemental strand, 30898089 - 30897851
Alignment:
| Q |
6 |
atactcaaacaacacgaaagaagatatatatgttataggtcaaattttgatgaaattttctaatttattcattgattacttttcttggataacatgggat |
105 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30898089 |
atactcaaacaacacgaaagaagatat----gttataggtcaaattttgatgaaattttctaatttattcattgattacttttcttggataacatgggat |
30897994 |
T |
 |
| Q |
106 |
annnnnnnacctttctataatatgtccttaatctaaagatacaaattattctttaacaatattccacgttgaagatgtttacagccactcttcaacctac |
205 |
Q |
| |
|
| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30897993 |
atttttctacctttctataatatgtccttaatctaaaaatacaaattattctttaacaatattccacgttgaagatgtttacagccactcttcaacctac |
30897894 |
T |
 |
| Q |
206 |
tctatatgagtacaagatatcaacctccgttcacattaattgt |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30897893 |
tctatatgagtacaagatatcaacctccgttcacattaattgt |
30897851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 40 - 88
Target Start/End: Complemental strand, 30899357 - 30899309
Alignment:
| Q |
40 |
ataggtcaaattttgatgaaattttctaatttattcattgattactttt |
88 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||| ||||||||||||| |
|
|
| T |
30899357 |
ataggtcaaatttggatgaaatgttctaatttattgattgattactttt |
30899309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University