View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8390_high_11 (Length: 313)
Name: NF8390_high_11
Description: NF8390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8390_high_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 74; Significance: 6e-34; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 93 - 166
Target Start/End: Complemental strand, 38377523 - 38377450
Alignment:
| Q |
93 |
cgtgttttggtgtaacattttatctttcaattttatatagtttgtactcaaaaagcatgttggcatttaagaag |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38377523 |
cgtgttttggtgtaacattttatctttcaattttatatagtttgtactcaaaaagcatgttggcatttaagaag |
38377450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 240 - 297
Target Start/End: Complemental strand, 38377377 - 38377320
Alignment:
| Q |
240 |
atgtgttttttgttggtgttatccttttgacagtgtttttctctctactcttgaaaca |
297 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
38377377 |
atgtgttttttgttcgtgttatccttttgacagtgtttttctctctacacttgaaaca |
38377320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 97 - 130
Target Start/End: Complemental strand, 10578133 - 10578100
Alignment:
| Q |
97 |
ttttggtgtaacattttatctttcaattttatat |
130 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
10578133 |
ttttggtgtaacattttttctttcaattttatat |
10578100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 96 - 128
Target Start/End: Original strand, 7047508 - 7047540
Alignment:
| Q |
96 |
gttttggtgtaacattttatctttcaattttat |
128 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
7047508 |
gttttggtgtaacattttctctttcaattttat |
7047540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University