View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8390_high_11 (Length: 313)

Name: NF8390_high_11
Description: NF8390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8390_high_11
NF8390_high_11
[»] chr7 (2 HSPs)
chr7 (93-166)||(38377450-38377523)
chr7 (240-297)||(38377320-38377377)
[»] chr4 (2 HSPs)
chr4 (97-130)||(10578100-10578133)
chr4 (96-128)||(7047508-7047540)


Alignment Details
Target: chr7 (Bit Score: 74; Significance: 6e-34; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 93 - 166
Target Start/End: Complemental strand, 38377523 - 38377450
Alignment:
93 cgtgttttggtgtaacattttatctttcaattttatatagtttgtactcaaaaagcatgttggcatttaagaag 166  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38377523 cgtgttttggtgtaacattttatctttcaattttatatagtttgtactcaaaaagcatgttggcatttaagaag 38377450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 240 - 297
Target Start/End: Complemental strand, 38377377 - 38377320
Alignment:
240 atgtgttttttgttggtgttatccttttgacagtgtttttctctctactcttgaaaca 297  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||    
38377377 atgtgttttttgttcgtgttatccttttgacagtgtttttctctctacacttgaaaca 38377320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 97 - 130
Target Start/End: Complemental strand, 10578133 - 10578100
Alignment:
97 ttttggtgtaacattttatctttcaattttatat 130  Q
    ||||||||||||||||| ||||||||||||||||    
10578133 ttttggtgtaacattttttctttcaattttatat 10578100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 96 - 128
Target Start/End: Original strand, 7047508 - 7047540
Alignment:
96 gttttggtgtaacattttatctttcaattttat 128  Q
    |||||||||||||||||| ||||||||||||||    
7047508 gttttggtgtaacattttctctttcaattttat 7047540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University