View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8390_high_14 (Length: 240)
Name: NF8390_high_14
Description: NF8390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8390_high_14 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 85 - 240
Target Start/End: Original strand, 11247466 - 11247621
Alignment:
| Q |
85 |
cagagttcttagttcataccgttaacacatcagaaagttttgtcatctcttcaatccgattagcatggctgttgagagtggccgcagattgcgccgttgc |
184 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
11247466 |
cagagttcttatttcataccgttaacacatcagaaagttttgtcatctcttcaatccgattagcatggctgttgagagtggccgcagattgcgccgtagc |
11247565 |
T |
|
| Q |
185 |
cccgacaccgccaggcctcacacacctctctccggtggccctaatctcagcagcac |
240 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
11247566 |
cccgacaccgtcaggcctcacacacctctctccggtagccctaatctcagcagcac |
11247621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University