View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8390_high_15 (Length: 239)
Name: NF8390_high_15
Description: NF8390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8390_high_15 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 180; Significance: 2e-97; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 56 - 239
Target Start/End: Original strand, 43195506 - 43195689
Alignment:
| Q |
56 |
gtttcatttacaaaattgtaagaaaggagattggtttcatgatctacaagtacgtttgtgattttaatttataaaaaggggttaagcttttctatttgct |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43195506 |
gtttcatttacaaaattgtaagaaaggagattggtttcatgatctacaagtacgtttgtgattttaatttataaaaaggggttaagcttttctatttgct |
43195605 |
T |
 |
| Q |
156 |
tcttagttatgtttaattgtttgtgttccttagcgaaaaaatcttgttgggcagtaatatgtaaatagttttgtgactttgtct |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
43195606 |
tcttagttatgtttaattgtttgtgttccttagcgaaaaaatcttgttggggagtaatatgtaaatagttttgtgactttgtct |
43195689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 58 - 135
Target Start/End: Original strand, 43181157 - 43181234
Alignment:
| Q |
58 |
ttcatttacaaaattgtaagaaaggagattggtttcatgatctacaagtacgtttgtgattttaatttataaaaaggg |
135 |
Q |
| |
|
|||||||||||||||||||||| ||| | |||| || ||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
43181157 |
ttcatttacaaaattgtaagaacggaagctagtttgataatctacaaggtcaattgtgattttaatttataaaaaggg |
43181234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University