View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8390_high_17 (Length: 228)
Name: NF8390_high_17
Description: NF8390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8390_high_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 13 - 123
Target Start/End: Complemental strand, 43196054 - 43195944
Alignment:
| Q |
13 |
aggtaccaggaatagtgtttccaatccatacaaacgtttagtttagagaatgtcattgacttattagtagaaacatgtcagatcttagatccacaagtca |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43196054 |
aggtaccaggaatagtgtttccaatccatacaaacgtttagtttagagaatgtcattgacttattagtagaaacatgtcagatcttagatccacaagtca |
43195955 |
T |
 |
| Q |
113 |
atggaatagtg |
123 |
Q |
| |
|
||||||||||| |
|
|
| T |
43195954 |
atggaatagtg |
43195944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 148 - 228
Target Start/End: Complemental strand, 43195949 - 43195869
Alignment:
| Q |
148 |
atagtgcgaagaaaaaataagtgaaaaattattataaacatggagggttacattgagnnnnnnnacaccataacaattcta |
228 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43195949 |
atagtgcgaagaaaaaataagcgaaaaattattataaacatggagggttacattgagtttttttacaccataacaattcta |
43195869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University