View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8390_low_12 (Length: 334)
Name: NF8390_low_12
Description: NF8390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8390_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 21 - 326
Target Start/End: Complemental strand, 47996277 - 47995972
Alignment:
| Q |
21 |
ctttattttcttcatgtcacccttcaatcttcattgatgatgttatatatacgtaggtttggattcttggcagcactgctccttcttgttggaatcaaat |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
47996277 |
ctttattttcttcatgtcacccttcaatcttcattgatgatgttatatatacgtacgtttggattcttggcagcactgctccttcttgatggaatcaaat |
47996178 |
T |
 |
| Q |
121 |
gcaaaagattggttttgaaaccaatttgattgttctcaaaatgacaaggttgatcctcgtcaatcttacccatctttttcacctcggtattgcttttata |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
47996177 |
gcaaaagattggttttgaaaccaatttgattgctctcaaaatgacaaggttgatcctcgtcaatcttacccatctttttcacctcagtattgcttttata |
47996078 |
T |
 |
| Q |
221 |
ccccaaagttgattgtttttgcctcgatgcaatatgatttcctccattcgcgttgatgttgtttggcttaggcaagtgtggaatgtgatttgcagctcca |
320 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
47996077 |
ccccaaatttgattgtttttgcctcgatgcaatatgatttcctccattcgtgttgatgttgtttggcttaggcaagtatggaatgtgatttgcagctcca |
47995978 |
T |
 |
| Q |
321 |
acacca |
326 |
Q |
| |
|
|||||| |
|
|
| T |
47995977 |
acacca |
47995972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University