View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8390_low_14 (Length: 286)
Name: NF8390_low_14
Description: NF8390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8390_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 18 - 272
Target Start/End: Complemental strand, 43371504 - 43371250
Alignment:
| Q |
18 |
gtttacagcagacacacttgctattgcaataaatgagatttctacatgataatggtagtttagaatataatttagattaaagaaagtgtagttaagtagt |
117 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
43371504 |
gtttgcagcagacacacttgctcttgcaataaatgagatttctacatgataatggtagtttagaatataatttagattaaagaaagtgtagataagtagt |
43371405 |
T |
 |
| Q |
118 |
tagttttacaattttaagcagttaatattatggtagttaagtctacatagaagctcgtttaagtgttgatagtgacctgaagttgtagactttgttttgc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43371404 |
tagttttacaattttaagcagttaatattatggtagttaagtctatatagaagctcgtttaagtgttgatagtgacctgaagttgtagactttgttttgc |
43371305 |
T |
 |
| Q |
218 |
cttagaatattaatcattcttgggaatggtatcatcatgtaaatgattctgtgat |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43371304 |
cttagaatattaatcattcttgggaatggtatcatcatgtaaatgattctgtgat |
43371250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University