View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8390_low_15 (Length: 244)
Name: NF8390_low_15
Description: NF8390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8390_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 11247634 - 11247869
Alignment:
| Q |
1 |
catcattctgatcaaccggtttatcaccacccgatacccccgccgcttctaacgcctctccgatggtgatcggatcgccatctatagccgcagagcccat |
100 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||| ||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11247634 |
catcattctgatccaccggtttatcaccaaccgatatccctgcagcttctaacgcctctccgatggtgatcggatcgccatctatagccgcagagcccat |
11247733 |
T |
 |
| Q |
101 |
attcataggcacaaagtgcgcgtcaggctccacgcgccgtcctataatctgaccatcaaccgcctccgtcacaacacgacggtcagcagccgttgtttcc |
200 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
11247734 |
attcataggcacaaagtgcgcatcaggctccacgcgccgccctataatctgaccatcaaccgcctccgtcacaacacgacggttagcagccgttgtttcc |
11247833 |
T |
 |
| Q |
201 |
gtcacacgaataccatgatctttgaccatctctgct |
236 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |
|
|
| T |
11247834 |
gtcacacgaataccatgatctttgaccatttctgct |
11247869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University