View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8390_low_20 (Length: 221)
Name: NF8390_low_20
Description: NF8390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8390_low_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 5716117 - 5715904
Alignment:
| Q |
1 |
tgttaatgagagtccaaaagatgaatttccttgtgagaggggactacaacaaggtaatccactattttcttttctatttttactgattgctgaaataatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5716117 |
tgttaatgagagtccaaaagatgaatttccttgtgagaggggactacaacaaggtaatccactattttcttttctatttttactaattgctgaaataatg |
5716018 |
T |
 |
| Q |
101 |
aatgtgatgatgattgatactatagagacatg--------nnnnnnnnnnctttcttctggttatgatgttggaggtactagatcactgaatatttctca |
192 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
5716017 |
aatgtgatgatgattgttactatagagacatgttttttttttctttctttctttcttctggttatgatgttggaggtaccagatcactgaatatttctca |
5715918 |
T |
 |
| Q |
193 |
tttataatttgatg |
206 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
5715917 |
tttataatttgatg |
5715904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University