View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8390_low_4 (Length: 418)
Name: NF8390_low_4
Description: NF8390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8390_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 374; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 374; E-Value: 0
Query Start/End: Original strand, 18 - 407
Target Start/End: Original strand, 37191082 - 37191471
Alignment:
| Q |
18 |
aatcacttgaattatttaagcaatgccagtttggatgacctttccaaattattattctttctcttaattcatttaatcactttgattattgctctgttca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| || |
|
|
| T |
37191082 |
aatcacttgaattatttaagcaatgccagtttggatgacctttccaaattattattctttctcttaattcatttaatcactttgattactgctctgtcca |
37191181 |
T |
|
| Q |
118 |
tcgagtttaaagcacacctcaagcgtaggctttagcctgttagttcacaaaattgaacaaaccaaatctccacaaaaattactaattaagcagccatcta |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37191182 |
tcgagtttaaagcacacctcaagcgtaggctttagcctgttagctcacaaaattgaacaaaccaaatctccacaaaaattactaattaagcagccatcta |
37191281 |
T |
|
| Q |
218 |
gaaaattttagagtagcatacgccactctttgcagctcttcatttacaaaagttccacatgtcaaattcctagtgtttcttgaatccttattatttcatt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37191282 |
gaaaattttagagtagcatacgccactctttgcagctcttcatttacaaaagttccacatgtcaaattcctagtgtttcttgaatccttattatttcatt |
37191381 |
T |
|
| Q |
318 |
ccctcaaccaaccacctctagccactagacatagagaaattcacctttttcagccttaaatgccttattttcttgtcgtttttcttctct |
407 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
37191382 |
ccctcaaccaaccacctctagccactagacatagagaaattcacctttttcagccttaaatgccttattttctagtcgtttttcttctct |
37191471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University