View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8391_low_14 (Length: 228)
Name: NF8391_low_14
Description: NF8391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8391_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 3 - 224
Target Start/End: Original strand, 44542576 - 44542797
Alignment:
| Q |
3 |
attattaataaaagaatgttttaaatcgctgtctgcaaccgcaatcacggcgtaaaggtttgcagcataactgcaatggcgatcataactgcaattacga |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44542576 |
attattaataaaagaatgttttaaatcgctgtctgcaaccgcaatcacggcataaaggtttgcagcataactgcaatggcgatcataactgcaattacga |
44542675 |
T |
 |
| Q |
103 |
ccgcaatttaaaaagatacacatttaccaatcaactatgtgtgatatgtgtatattaattaattgttatatcatacgatgtggcatcctcctcaagttgg |
202 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44542676 |
ccgcaatttaaaaagatacacatttactaatcaactatgtgtgatatgtgtatattaattaattgttatatcatacgatgtggcatcctcctcaagttgg |
44542775 |
T |
 |
| Q |
203 |
gatgttgaattttgaagagagt |
224 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
44542776 |
gatgttgaattttgaagagagt |
44542797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University