View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8391_low_15 (Length: 204)
Name: NF8391_low_15
Description: NF8391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8391_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 1 - 188
Target Start/End: Complemental strand, 53538755 - 53538567
Alignment:
| Q |
1 |
ccctcactcattagtcttctctctttttaaccacttcaataatttattcctttatg-tgagctcatttattcagtggattgtagcagcggtatttgggag |
99 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| | | | ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
53538755 |
ccctcactcattagtcttttctctttttaaccacttcaataatttattcctttaaaattaccattttttttcagtggattgtagcagcggtatttgggag |
53538656 |
T |
 |
| Q |
100 |
cattttggggagctctatgtgatctgtctgccaaggggttatatcagagcaaacagcagctgattgaatgaattatagaaggaaggtta |
188 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53538655 |
cattttggggagctctatgtgatctgtcagccagggggttatatcagagcaaacagcagctgattgaatgaattatagaaggaaggtta |
53538567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 3 - 51
Target Start/End: Complemental strand, 7120084 - 7120036
Alignment:
| Q |
3 |
ctcactcattagtcttctctctttttaaccacttcaataatttattcct |
51 |
Q |
| |
|
|||||||||| || | ||||| |||||||||||||||||||||||||| |
|
|
| T |
7120084 |
ctcactcatttgtttcttctctatttaaccacttcaataatttattcct |
7120036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University