View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8392_high_10 (Length: 264)
Name: NF8392_high_10
Description: NF8392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8392_high_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 252
Target Start/End: Complemental strand, 38620791 - 38620536
Alignment:
| Q |
1 |
attatgcaaatgttagaccttgatgcagcaagtatgtcatgtggatgagcct----ttctatcactatgctttgtgttccaaagatatttaatgcatgta |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38620791 |
attatgcaaatgttagaccttgatgcagcaagtatgtcatgtggatgagcctgcctttctatcactatgcattgtgttccaaagatatttaatgcatgta |
38620692 |
T |
|
| Q |
97 |
tggaattggcggtgaatttgacaaaatcacaatgctaaattgtgaatccgacagattcactgtcaatccaaatgtgcacttatacacttgctttgttaac |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| ||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38620691 |
tggaattggcggtgaatttgacaaaatcacagtgctacattgtgattccgacagattcaccgtcaatccaaatgtgcacttatacacttgctttgttaac |
38620592 |
T |
|
| Q |
197 |
attttcccatttaattaaaacacgggtctagtagcccgagtctctaattaaactca |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38620591 |
attttcccatttaattaaaacacgggtctagtagcccgagtctcttattaaactca |
38620536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University