View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8392_high_17 (Length: 219)

Name: NF8392_high_17
Description: NF8392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8392_high_17
NF8392_high_17
[»] chr5 (1 HSPs)
chr5 (121-200)||(16087730-16087805)


Alignment Details
Target: chr5 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 121 - 200
Target Start/End: Complemental strand, 16087805 - 16087730
Alignment:
121 ttgtgttgattttaaaatttctaccgttcaaattgtgatcttggttttttaaactattattttgagcaaaatgtgtttga 200  Q
    |||||||||||||||| |||||||| | |||||||||||||||||||||  |||||||||||||||||||||||||||||    
16087805 ttgtgttgattttaaa-tttctaccat-caaattgtgatcttggttttt--aactattattttgagcaaaatgtgtttga 16087730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University