View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8392_high_17 (Length: 219)
Name: NF8392_high_17
Description: NF8392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8392_high_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 121 - 200
Target Start/End: Complemental strand, 16087805 - 16087730
Alignment:
| Q |
121 |
ttgtgttgattttaaaatttctaccgttcaaattgtgatcttggttttttaaactattattttgagcaaaatgtgtttga |
200 |
Q |
| |
|
|||||||||||||||| |||||||| | ||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
16087805 |
ttgtgttgattttaaa-tttctaccat-caaattgtgatcttggttttt--aactattattttgagcaaaatgtgtttga |
16087730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University