View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8392_high_8 (Length: 283)
Name: NF8392_high_8
Description: NF8392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8392_high_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 24 - 276
Target Start/End: Original strand, 42983553 - 42983811
Alignment:
| Q |
24 |
gaggccctcatattccacctgat------accaatgatttctcattcacaccttttctataataggtttgttcatatcaatttggatacaaacccaatca |
117 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42983553 |
gaggccctcatattccacctgatagtgataccaatgatttctcattcacaccttttctataataggtttgttcatatcaatttggatacaaacccaatca |
42983652 |
T |
|
| Q |
118 |
aatcttcctattcacacgttgttataataaaacacattcaataccggaaaatgtatccaaatcattgtttgatcaatcttagccgttgggggaagcaaac |
217 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42983653 |
aatcttcctattcagacgttgttataataaaacacattcaataccggaaaatgtatccaaatcattgtttgatcaatcttagccgttgggggaagcaaac |
42983752 |
T |
|
| Q |
218 |
tctaatgtccaacattgcaaggctaagtaatgatnnnnnnnntcatccagtgaccacca |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
42983753 |
tctaatgtccaacattgcaaggctaagtaatgataaaaaaaatcatccagtgaccacca |
42983811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University