View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8392_high_9 (Length: 279)
Name: NF8392_high_9
Description: NF8392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8392_high_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 20 - 264
Target Start/End: Complemental strand, 38763932 - 38763688
Alignment:
| Q |
20 |
ggtcccaccatagataatgttttggctgattggaagcctgtcatactcagattgtataataaagaaccagaattatttctgaacctccttgaggaagttc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38763932 |
ggtcccaccatagataatgttttggctgattggaagcctgtcatactcagattgtataataaagaaccagaattatttctgaacctccttgaggaagttc |
38763833 |
T |
|
| Q |
120 |
ttcataggattgaagctcgggaagatatgaagtgtgaagaaggtaggcagagattgatttccgaccacaactctcctttacattggaagtttcaatttgc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38763832 |
ttcataggattgaagctcgggaagatatgaagtgtgaagaaggtaggcagagattgatttccgaccacaactctcctttacattggaagtttcaatttgc |
38763733 |
T |
|
| Q |
220 |
ttaattgttgtgggtgcttgtgtcttttaatgaactatttatttg |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
38763732 |
ttaattgttgtgggtgcttgtgtcttttaatgcactatttatttg |
38763688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University