View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8392_low_16 (Length: 241)
Name: NF8392_low_16
Description: NF8392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8392_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 38620493 - 38620269
Alignment:
| Q |
1 |
ttgcagccaaacccaggactttcataagaacagtttttctacaaatgctgtcaggtaagaattagaaactattgttttattttgttttgagaaggaaaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38620493 |
ttgcagccaaacccaggactttcataagaacagtttttctacaaatgctgtcaggtaagaattagaaactattgttttattttgttttgagaaggaaaac |
38620394 |
T |
|
| Q |
101 |
ctaaattgatcacaatttcgtcctctgcattataaccattcttatg--atattctcaacatttgcagaaaatgagtgggcatttgatttgctttattgtg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38620393 |
ctaaattgatcacaatttcgtcctctgcattataaccattcttatgatatattctcaacatttgcagaaaatgagtgggcatttgatttgctttattgtg |
38620294 |
T |
|
| Q |
199 |
tggcatttgtggttatggacaaaca |
223 |
Q |
| |
|
||||||||||||||||||| ||||| |
|
|
| T |
38620293 |
tggcatttgtggttatggataaaca |
38620269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University