View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8392_low_18 (Length: 239)
Name: NF8392_low_18
Description: NF8392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8392_low_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 53123776 - 53123998
Alignment:
| Q |
1 |
aggcttaatggatgtgtttactcaaccttccatggcattgcagtgttatgtgcaaaaatgaacgagtggctgaaatgccaacgattcccttgcaagtgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53123776 |
aggcttaatggatgtgtttactcaaccttccatggcattgcagtgttatgtgcaaaaatgaacgagtggctgaaatgccaacgattcccttgcaagtgaa |
53123875 |
T |
|
| Q |
101 |
aaagaagtgtaaaacgcaacataatcacaaccataacataattcaggctcagaaactctagcatgaggcatggatttcttaaccacttgaaaaccccgca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
53123876 |
aaagaagtgtaaaacgcaacataatcacaaccataacataattcaggctcagaaactctagcatgaggcatggatttcttaaccacttgaaaaccccaca |
53123975 |
T |
|
| Q |
201 |
tgcaaattgcatcaccacaatac |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
53123976 |
tgcaaattgcatcaccacaatac |
53123998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University