View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8392_low_19 (Length: 231)
Name: NF8392_low_19
Description: NF8392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8392_low_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 18 - 221
Target Start/End: Original strand, 25710336 - 25710539
Alignment:
| Q |
18 |
gatatgtggttgaaaacctttcaatatgtgaggaagaagagtattttatcaggatttgattgaaaatgtctcatacgggactaaaacaagtattttgaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25710336 |
gatatgtggttgaaaacctttcaatatgtgaggaagaagagtattttatcaggatttgattgaaaatgtctcatacgggactaaaacaagtattttgaaa |
25710435 |
T |
 |
| Q |
118 |
gagaagaaaatactcatgcttggagatgtttcgagcagagaattgaagttattgtattttcctttgttttctttccatagtgccaaaatcctatcttctt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
25710436 |
gagaagaaaatactcatgcttggagatgtttcgagcagagaattgaagttattgtattttcctttgttttctttccccagtgccaaaatcctatcttctc |
25710535 |
T |
 |
| Q |
218 |
ctca |
221 |
Q |
| |
|
|||| |
|
|
| T |
25710536 |
ctca |
25710539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 101 - 142
Target Start/End: Original strand, 25711445 - 25711484
Alignment:
| Q |
101 |
aaacaagtattttgaaagagaagaaaatactcatgcttggag |
142 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
25711445 |
aaacaagtattttgaaagaga--aaaatactcatgcttggag |
25711484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University