View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8392_low_8 (Length: 321)
Name: NF8392_low_8
Description: NF8392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8392_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 15 - 302
Target Start/End: Complemental strand, 27764579 - 27764292
Alignment:
| Q |
15 |
cagagataccaaattagagatagaaatataattactatcatatcaaataaaggatcaatataattgcataccttggcactgatagagtagaacaccaaag |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27764579 |
cagagataccaaattagagatagaaatataattactatcatatcaaataaaggatcaatataattgcataccttggcactgatagagtagaacaccaaag |
27764480 |
T |
 |
| Q |
115 |
gttgtatggtagtgacattgagatgtaggatactaaggaagagtgtttgaaaaccagccactaatttagttagttgtcctggtcttgtcctagtgagaat |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27764479 |
gttgtatggtagtgacattgagatgtaggatactaaggaagagtctttgaaaaccagccactaatttagttagttgtcctggtcttgtcctagtgagaat |
27764380 |
T |
 |
| Q |
215 |
tctaaggtttgcatgagtctcgatcaatgtaacctcgatatcagctatggcagctttggtcttggatgtgtatttgttaggtgtttgg |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27764379 |
tctaaggtttgcatgagtctcgatcaatgtaacctcgatatcagctatggcagctttggtcttggatgtgtatttgttaggtgtttgg |
27764292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University