View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8392_low_9 (Length: 295)
Name: NF8392_low_9
Description: NF8392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8392_low_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 1 - 285
Target Start/End: Complemental strand, 38763507 - 38763223
Alignment:
| Q |
1 |
ttatattgatctcttttgcagataacccaagtattgggattgcatactcaaagaaagagtttcatcgaagttcttatctttcttctttgtttgcatggct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38763507 |
ttatattgatctcttttgcagataacccaagtattgggattgcatactcaaagaaagagtttcatcgaagttcttatctttcttctttgtttgcatggct |
38763408 |
T |
|
| Q |
101 |
tgttcgaattcttggcaaaacaccttctaatgcagcaaatatgccgaagagggttttgcatgaacttgttcgtaaatgtcttctaatatcacatctctgc |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38763407 |
tgttcgaattcttggcaaaacatcttctaatgcagcaaatatgccgaagagggttttgcatgaacttgttcgtaaatgtcttctaatatcacatctctgc |
38763308 |
T |
|
| Q |
201 |
gacaagcaggtcatggattcagctcttcatctcgcacaactgatatatgacagatctttgttgcagaaagttcaattgctctctg |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38763307 |
gacaagcaggtcatggattcagctcttcatctcgcacaactgatatatgacagatctttgttgcagaaagttcaattgctctctg |
38763223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University