View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8393_high_3 (Length: 248)
Name: NF8393_high_3
Description: NF8393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8393_high_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 16 - 231
Target Start/End: Complemental strand, 36673415 - 36673200
Alignment:
| Q |
16 |
agagagtctgaccatatctcacaacacagcataatgaatcattgttgcagcagcaaacatgaaaacatacacgcaaaaacacatgagatttaaacctata |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
36673415 |
agagagtctgaccatatctcacaacacagcataatgaatcattgttgcagcagcaaacatgaaaacatacacgtaaaaacacatgagatttaaacctata |
36673316 |
T |
|
| Q |
116 |
ccggtgttcaaaatttaggctaatgccacaatgcaaatatcttaatgctagaatattgttcaaaattgaggacaaaatcattcaatttcttatgggattg |
215 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36673315 |
ccggtgttcaaaatttaggctaatgctacaatgcaaatatcttaatgctagaatattgttcaaaattgaggacaaaatcattcaatttcttatgggattg |
36673216 |
T |
|
| Q |
216 |
aatgatcggtatcaag |
231 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
36673215 |
aatgatcggtatcaag |
36673200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 170 - 231
Target Start/End: Complemental strand, 23807195 - 23807134
Alignment:
| Q |
170 |
attgttcaaaattgaggacaaaatcattcaatttcttatgggattgaatgatcggtatcaag |
231 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
23807195 |
attgttcaaaatggaggtcaaaatcattcaattccttatgggattgaatgatcagtatcaag |
23807134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University