View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8393_low_4 (Length: 249)
Name: NF8393_low_4
Description: NF8393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8393_low_4 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 17 - 239
Target Start/End: Complemental strand, 34872429 - 34872207
Alignment:
| Q |
17 |
ggaagaatgtgcccgtcaaagttgtgcctcttcggtctgagggagaggatctgctccagctgttgaacgtgcggtccgatcctgatcgatatggccccca |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| ||||||||||| ||||||| |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34872429 |
ggaagaatgtgcccgtcaaagttgtgcctcttcagtctcagggagaggatttgctccaactgttgaacgtgtggtccgatcctgatcgatatggccccca |
34872330 |
T |
 |
| Q |
117 |
ctcgaccatttgccgcagtgatctaaagctgaaggttattcaagacctgggaaccgctggccggggtaaaactgcaatgactaaaggttattcaaagtgt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| ||||||||||||||||| |
|
|
| T |
34872329 |
ctcgaccatttgccgcagtgatctaaagctgaaggttattcaagacctgggaaccgctggccggagcaaaactgcaatgactgaaggttattcaaagtgt |
34872230 |
T |
 |
| Q |
217 |
ctacatatgcatcatgagttctt |
239 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
34872229 |
ctacatatgcatcatgagttctt |
34872207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University