View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8394_high_12 (Length: 305)
Name: NF8394_high_12
Description: NF8394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8394_high_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 14 - 289
Target Start/End: Complemental strand, 44498013 - 44497738
Alignment:
| Q |
14 |
agatgaagtctacagttccataaacatcacattcgcggtagaattgacggagggagtggacatagagagtgtcctggtaagccacaaagctacattgata |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44498013 |
agatgaagtctacagttccataaacatcacattcgcggtagaattgacggagggagtggacatagagagtgtcctggtaagccacaaagctacattgata |
44497914 |
T |
 |
| Q |
114 |
gaaggctgagaagtcggcaccatttctcaccgctaccgcttgatgtttgctaggtccggctgagttctcaaaggttatacctttggctatgaatttgtct |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44497913 |
gaaggctgagaagtcggcaccatttctcaccgctaccgcttgatgtttgctaggtccggctgagttctcaaaggttatacctttggctatgaatttgtct |
44497814 |
T |
 |
| Q |
214 |
cccacaacagctgaaaaccaccaatattcaattgtgtaaaaatttgaagaacaattgaagcaattaagcaaaatat |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44497813 |
cccacaacagctgaaaaccaccaatattcaattgtgtaaaaatttgaagaacaattgaagcaattaagcaaaatat |
44497738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 40 - 92
Target Start/End: Original strand, 16608315 - 16608367
Alignment:
| Q |
40 |
tcacattcgcggtagaattgacggagggagtggacatagagagtgtcctggta |
92 |
Q |
| |
|
|||||||| | ||||||||| | |||||||||||||||||| ||||| ||||| |
|
|
| T |
16608315 |
tcacattctctgtagaattgtctgagggagtggacatagagtgtgtcttggta |
16608367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University