View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8394_high_19 (Length: 240)
Name: NF8394_high_19
Description: NF8394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8394_high_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 18 - 228
Target Start/End: Complemental strand, 13067282 - 13067072
Alignment:
| Q |
18 |
gtgtttgtgaaccaccgtcctttaattttggacagaggagataaaaacgtcggtagcataccaattattgtccaatttggcataattctatcgctatccg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13067282 |
gtgtttgtgaaccaccgtcctttaattttggacagaggagataaaaacgtcgctagcataccaattattgtccaatttggcataattctatcgctatccg |
13067183 |
T |
 |
| Q |
118 |
tctcaaatagtggacagatatgaaaaaggggatggctacaaatcctgcaatacactgaatcttgcacattgcagatttacctaagtatgttttgacttgc |
217 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13067182 |
tctccaatagtggacagatatgaaaaaggggatggctacaaatcctgcaatacactgaatcttgcacattgcagatttacctaagtatgttttgacttgc |
13067083 |
T |
 |
| Q |
218 |
aattgtctatg |
228 |
Q |
| |
|
||||||||||| |
|
|
| T |
13067082 |
aattgtctatg |
13067072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 147 - 207
Target Start/End: Original strand, 13008484 - 13008544
Alignment:
| Q |
147 |
ggatggctacaaatcctgcaatacactgaatcttgcacattgcagatttacctaagtatgt |
207 |
Q |
| |
|
||||||||||||||||| ||||||||||||| || |||||| |||||||| |||||||| |
|
|
| T |
13008484 |
ggatggctacaaatcctccaatacactgaattatggacattgtagatttactaaagtatgt |
13008544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 137 - 197
Target Start/End: Complemental strand, 30367011 - 30366951
Alignment:
| Q |
137 |
atgaaaaaggggatggctacaaatcctgcaatacactgaatcttgcacattgcagatttac |
197 |
Q |
| |
|
||||| ||| |||| |||||||||||| ||||||| |||||| | ||||||| |||||||| |
|
|
| T |
30367011 |
atgaagaagaggatagctacaaatcctccaatacattgaatcatacacattgtagatttac |
30366951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University