View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8394_low_18 (Length: 266)
Name: NF8394_low_18
Description: NF8394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8394_low_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 19 - 255
Target Start/End: Complemental strand, 28343224 - 28342988
Alignment:
| Q |
19 |
aaacctatatctaatcaaattccaaggtgatgcattttcctcaaacaatgttcttcagctaacaaaaaaccaacttgatggccctatcacaagaagcgtc |
118 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28343224 |
aaacctatatctaataaaattccaaggtgatgcattttcctcaaacaatgttcttcagctaacaaaaaaccaacttgatggccctatcacaagaagcgtc |
28343125 |
T |
|
| Q |
119 |
ggccgcgcttcgtttgatcaacctttgaagctttatgataaagaaacaaaagagctcactgatttcacaacacatttcacctttattatgagagctgtta |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28343124 |
ggccgcgcttcgtttgatcaacctttgaagctttatgataaagaaacaaaagagctcactgatttcacaacacatttcacctttattatgagagctgtta |
28343025 |
T |
|
| Q |
219 |
atttatcgatgtttggtgacggtctatcgttcttcat |
255 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |
|
|
| T |
28343024 |
atttatcgctgtttggtgacggtctatcgttcttcat |
28342988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University