View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8394_low_19 (Length: 263)
Name: NF8394_low_19
Description: NF8394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8394_low_19 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 19 - 263
Target Start/End: Complemental strand, 53089698 - 53089438
Alignment:
| Q |
19 |
tgtttatggtttaaaatttacacttccacacatgattaatagtttattgttgttcgtct----------------atagattcacaatggagcaaatgaa |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
53089698 |
tgtttatggtttaaaatttacacttccacacatgattaataatttattgttgttcgtctccatgtcttctaatatatagattcacaatggagcaaatgaa |
53089599 |
T |
|
| Q |
103 |
aatggggttgatcagtcttcaagggttgaaaacgttacagctgagctggaggaaacacgagaaaatctagagaaagctaaagaagaaagcatgttgatgg |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53089598 |
aatggggttgatcagtcttcaagggttgaaaacgttacagctgagctggaggagacacgagaaaatctagagaaagctaaagaagaaagcatgttgatgg |
53089499 |
T |
|
| Q |
203 |
cacattgtatgtcatctcttcaggaagaactcgaacgcacgaagcaagagctcgaacaatt |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53089498 |
cacattgtatgtcatctcttcaggaagaactcgaacgcacgaagcaagagctcgaacaatt |
53089438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University