View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8394_low_25 (Length: 208)
Name: NF8394_low_25
Description: NF8394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8394_low_25 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 146; Significance: 4e-77; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 21 - 178
Target Start/End: Original strand, 29776252 - 29776409
Alignment:
| Q |
21 |
cctgcagcgcacatcatcttattagatactactaaacagtgaacaagactaacacattcataaattagctaaaacattcatacaaaccagagtttagagg |
120 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29776252 |
cctgcagtgcacagcatcttattagatactactaaacagtgaacaagactaacacattcataaattagctaaaacattcatacaaaccagagtttagagg |
29776351 |
T |
|
| Q |
121 |
taatccacaaatcttcgcgcttcactacgccctcatccaacaacttcttcaacaccaa |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
29776352 |
taatccacaaatcttcgcgcttcactacgccctcatcgaacaacttcttcaacaccaa |
29776409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 102 - 172
Target Start/End: Original strand, 29786681 - 29786751
Alignment:
| Q |
102 |
acaaaccagagtttagaggtaatccacaaatcttcgcgcttcactacgccctcatccaacaacttcttcaa |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || ||||||||||| || | ||||| |||||||| |
|
|
| T |
29786681 |
acaaaccagagtttagaggtaatccacaaatcttcacgtttcactacgccttcggcaaacaatttcttcaa |
29786751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University