View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8394_low_9 (Length: 408)
Name: NF8394_low_9
Description: NF8394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8394_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 5e-72; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 5e-72
Query Start/End: Original strand, 14 - 236
Target Start/End: Complemental strand, 10395740 - 10395522
Alignment:
| Q |
14 |
cagtttaaatgatgttggacctgagtatcacaacatatcaaccatatattatccatgctcgtgaaaccccgtcagttaagaggatttgcatgatctcctt |
113 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||| |||| ||||||||||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
10395740 |
cagtttaaatgatcttggacctgagtatcacaacatatcaac----tattgtccatgctcgtgaaaccccgtcaattaagaggatttgtatgatctcctt |
10395645 |
T |
 |
| Q |
114 |
actgagtttgaaaactatcttaaaagatatgaaaatgtcacatgaaactcctcaatacctgacattgctatgacacctgctaccttcaaaggaaaacaac |
213 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||||||||||| |||||| |||||| ||| |||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
10395644 |
actgagtttgaaaactatctcaaaagagatgaaaatgtcacataaaactcttcaatatctgtcattgctatgacacatgccgccttcaaaggaaaacaac |
10395545 |
T |
 |
| Q |
214 |
aacctttcatgcatgctataact |
236 |
Q |
| |
|
|||||| ||| | ||||| |||| |
|
|
| T |
10395544 |
aaccttgcatccgtgctacaact |
10395522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 228 - 392
Target Start/End: Complemental strand, 10395211 - 10395041
Alignment:
| Q |
228 |
gctataacttcacgtgaatctcaaagctatttctgattcacattccctggttgtcccaa--acgttattttccaattttgtg----acaaacaagggaat |
321 |
Q |
| |
|
|||| ||||||||||||| || ||||||||||| ||||||||||||||||||||||||| | |||||||| |||||||||| |||||||||||||| |
|
|
| T |
10395211 |
gctacaacttcacgtgaagctaaaagctatttccgattcacattccctggttgtcccaaatatgttattttgcaattttgtgacaaacaaacaagggaat |
10395112 |
T |
 |
| Q |
322 |
gctgctaaagtttgttccaaacatcaaggatggtttcgactttcgcatttccctagttctcaccatgcaac |
392 |
Q |
| |
|
|||||||||||||||| ||||||| |||||| || || ||| ||||||||| |||||||||||||||| |
|
|
| T |
10395111 |
gctgctaaagtttgttacaaacattaaggatttgtttaacgttcacatttcccttgttctcaccatgcaac |
10395041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University