View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8395_high_13 (Length: 242)
Name: NF8395_high_13
Description: NF8395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8395_high_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 33624725 - 33624499
Alignment:
| Q |
1 |
gcaataacacattccacagtcccacaagaagaagaagatgaagacgaaatcgtcgaagaacaatgtcatgtaacattcaccgatttccccggtggctctg |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33624725 |
gcaataacacattccacagtcccagaagaagaagaagatgaagacgaaatcgtcgaagaacaatgtcatgtaacattcaccgatttccccggtggctctg |
33624626 |
T |
 |
| Q |
101 |
aggcgtttgagatggcagctaaattctgctatggtgttaaaatggaactgtcaccttccaatgtagcttcactccgttgcgccggtgagtttcttgagat |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33624625 |
aggcgtttgagatggcggctaaattctgctatggtgttaaaatggaactgtcaccttccaatgtagcttcactccgttgcgccggtgagtttcttgagat |
33624526 |
T |
 |
| Q |
201 |
gactgaagagtattccgaggataatct |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
33624525 |
gactgaagagtattccgaggataatct |
33624499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University