View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8395_low_11 (Length: 261)
Name: NF8395_low_11
Description: NF8395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8395_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 94 - 244
Target Start/End: Complemental strand, 48152681 - 48152531
Alignment:
| Q |
94 |
catagatgttgttgtttagccattttctgaagtcatacgtatgttgatgtttacccannnnnnnctctttctagtttagttgattatctgcataaggttt |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
48152681 |
catagatgttgttgtttagccattttctgaagtcatacgtatgttgatgtttacccatttttttctctttctagtttagttgattatctgcataaggttt |
48152582 |
T |
|
| Q |
194 |
acttgctagttatgcagatttggttggttgtgtctatttcacattgacagt |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48152581 |
acttgctagttatgcagatttggttggttgtgtctatttcacattgacagt |
48152531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 11 - 102
Target Start/End: Complemental strand, 48153450 - 48153359
Alignment:
| Q |
11 |
gaagcagagaagtagatatgttttatttcttttgctgaagtgtttggtcttcatatttgctgtgttgatatttattttgaagtcatagatgt |
102 |
Q |
| |
|
|||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48153450 |
gaagcacagaagttgatatgttttatttcttttgctgaagtgtttggtcttcatatttgctgtgttgatatttattttgaagtcatagatgt |
48153359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University