View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8395_low_15 (Length: 239)
Name: NF8395_low_15
Description: NF8395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8395_low_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 15 - 221
Target Start/End: Original strand, 41268442 - 41268648
Alignment:
| Q |
15 |
ttattcttaatgacattttcaagcaatgcttattggccaccttcacctggctactggccaagttcaaagttcaagtctatgaacttttacaaaggtttta |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41268442 |
ttattcttaatgacattttcaagcaatgcttattggccaccttcacctggctactggccaagttcaaagttcaagtctatgaacttttacaaaggtttta |
41268541 |
T |
 |
| Q |
115 |
caaaccgttggggccctcaacaccaaagactagaacaaaatgcattaactatttggcttgatagaacctcaggttctgagtctgatcatcagttacacat |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41268542 |
caaaccgttggggccctcaacaccaaagactagaacaaaatgcattaactatttggcttgatagaacctcaggttctgagtctgatcatcagttacacat |
41268641 |
T |
 |
| Q |
215 |
gttttct |
221 |
Q |
| |
|
||||||| |
|
|
| T |
41268642 |
gttttct |
41268648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 72; Significance: 7e-33; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 9 - 188
Target Start/End: Complemental strand, 27686215 - 27686036
Alignment:
| Q |
9 |
gctagattattcttaatgacattttcaagcaatgcttattggccaccttcacctggctactggccaagttcaaagttcaagtctatgaacttttacaaag |
108 |
Q |
| |
|
||||| |||||||| ||| | | |||||||||||| |||||||||||||| || || |||||||||||||| || ||| |||||||| ||||||||| | |
|
|
| T |
27686215 |
gctagtttattctttatggcttcttcaagcaatgcctattggccaccttcccccggttactggccaagttccaaagtcaggtctatgagcttttacaatg |
27686116 |
T |
 |
| Q |
109 |
gttttacaaaccgttggggccctcaacaccaaagactagaacaaaatgcattaactatttggcttgatagaacctcaggt |
188 |
Q |
| |
|
||| || ||||| |||||| |||||||||||||| | || ||| ||| | |||||||||||||||||||||||||||| |
|
|
| T |
27686115 |
gttatagaaacctttggggacctcaacaccaaagcatggatcaacatggaacaactatttggcttgatagaacctcaggt |
27686036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University