View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8395_low_18 (Length: 216)
Name: NF8395_low_18
Description: NF8395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8395_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 19 - 199
Target Start/End: Original strand, 56231839 - 56232019
Alignment:
| Q |
19 |
gctgaagcagttggaatgattctttgtaatgatcagtctaatggcaatgagcttattgctgatcctcatttcctgcctgcaacacagattacttatgcag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
56231839 |
gctgaagcagttggaatgattctttgtaatgatcagtctaatggcaatgagcttattgctgatcctcatttcctacctgcaacacagattacttatgcag |
56231938 |
T |
 |
| Q |
119 |
atggcgttgctctctttgcctacatcaattcaaccaagtaacttttgttgctctctccttttctcatcccttcatttgtat |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56231939 |
atggcgttgctctctttgcctacatcaattcaaccaagtaacttttgttgctctctccttttctcatcccttcatttgtat |
56232019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 23 - 196
Target Start/End: Original strand, 39189637 - 39189809
Alignment:
| Q |
23 |
aagcagttggaatgattctttgtaatgatcagtctaatggcaatgagcttattgctgatcctcatttcctgcctgcaacacagattacttatgcagatgg |
122 |
Q |
| |
|
||||||||||||||||||||| ||| |||| |||| ||||||||||||||| || ||||||||||||||| ||| || |||| |||| ||||| |||||| |
|
|
| T |
39189637 |
aagcagttggaatgattctttttaacgatcggtctcatggcaatgagcttactgatgatcctcatttcctacctacagcacatattatttatgaagatgg |
39189736 |
T |
 |
| Q |
123 |
cgttgctctctttgcctacatcaattcaaccaagtaacttttgttgctctctccttttctcatcccttcatttg |
196 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
39189737 |
tgttgctgtctttgcctacatcaattcaaccaagtaacttttgttgctc-ctccttttgtcatcccttcatttg |
39189809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 70 - 143
Target Start/End: Complemental strand, 43014434 - 43014361
Alignment:
| Q |
70 |
cttattgctgatcctcatttcctgcctgcaacacagattacttatgcagatggcgttgctctctttgcctacat |
143 |
Q |
| |
|
||||||||||||||| ||||| || | ||| ||||||||| ||||| |||||| |||||| | ||||||||||| |
|
|
| T |
43014434 |
cttattgctgatcctaatttcttgtcagcatcacagattaattatgaagatggtgttgctgtgtttgcctacat |
43014361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University