View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8396_high_6 (Length: 219)
Name: NF8396_high_6
Description: NF8396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8396_high_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 74; Significance: 4e-34; HSPs: 6)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 14 - 112
Target Start/End: Complemental strand, 32849873 - 32849779
Alignment:
| Q |
14 |
gtttcgtgttacagcgatatccaattattcaagctccctctatatatcgctcttcacttccactaacctcgtttcactcaggtaattaaaactagtata |
112 |
Q |
| |
|
||||| |||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32849873 |
gtttcctgttgcagcgatatccaattattcaagctccctctat----cgctcttcacttccactaacctcgtttcactcaggtaattaaaactagtata |
32849779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 136 - 199
Target Start/End: Complemental strand, 32849762 - 32849699
Alignment:
| Q |
136 |
gctttatgaattgtgatataacattgcttgtttgttcctcagtctcagaggtacaattaatcta |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32849762 |
gctttatgaattgtgatataacattgcttgtttgttcctcagtctcagaggtacaattaatcta |
32849699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 142 - 182
Target Start/End: Complemental strand, 4412931 - 4412891
Alignment:
| Q |
142 |
tgaattgtgatataacattgcttgtttgttcctcagtctca |
182 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
4412931 |
tgaattgtgatattacattacttgtttgttcctcagtctca |
4412891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 142 - 181
Target Start/End: Complemental strand, 4428034 - 4427995
Alignment:
| Q |
142 |
tgaattgtgatataacattgcttgtttgttcctcagtctc |
181 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
4428034 |
tgaattgtgatataatattacttgtttgttcctcagtctc |
4427995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 58 - 95
Target Start/End: Complemental strand, 4413697 - 4413660
Alignment:
| Q |
58 |
tatcgctcttcacttccactaacctcgtttcactcagg |
95 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
4413697 |
tatcgctcttcattcccactaacctcgtttcactcagg |
4413660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 136 - 177
Target Start/End: Original strand, 4460614 - 4460655
Alignment:
| Q |
136 |
gctttatgaattgtgatataacattgcttgtttgttcctcag |
177 |
Q |
| |
|
||||| || |||||||||||||||| |||||||||||||||| |
|
|
| T |
4460614 |
gctttctggattgtgatataacattacttgtttgttcctcag |
4460655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University