View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8397_high_4 (Length: 260)
Name: NF8397_high_4
Description: NF8397
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8397_high_4 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 1 - 260
Target Start/End: Original strand, 32816143 - 32816402
Alignment:
| Q |
1 |
acccctactttatcttgcttgcttatgttatgtggtccacgtttgagttcatatcatcatgcatcgaatttagagttagatcctttttatcctatcggtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
32816143 |
acccctactttatcttgcttgcttatgttatgtggtccacgtttgagttcatatcatcatgcatcgaatttagagttagatcctctttatcctatcggtg |
32816242 |
T |
 |
| Q |
101 |
tgtgtctcacttaattaagtaaatttctataaatatcatatcatattatcatgcatgcgactgtgtattaactcttgtgtaccttgcaagttagttagcc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
32816243 |
tgtgtctcacttaattaagtaaatttctataaatatcatatcatattattatgcatgcgactgtgtattaactcttgtgtaccttgcaagttagttaacc |
32816342 |
T |
 |
| Q |
201 |
agctgtcaagtttgttactctagcttgtaatgaaagtttgtgtattagagtccgttttga |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32816343 |
agctgtcaagtttgttactctagcttgtaatgaaagtttgtgtattagagtccgttttga |
32816402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University